Myo1d^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myo1d^em1(IMPC)J
• Name: myosin ID; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775818
• Synonyms: Myo1d^em1J
• Gene: Myo1d Location: Chr11:80372952-80670851 bp, - strand Genetic Position: Chr11, 47.95 cM
• Alliance: Myo1d^em1(IMPC)J page
• IMPC: Myo1d gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATTTGGTAATAAACTAAG, GAAACAGTTACTAGGACATT, TTTTAAATACCTTGCAGCTT and GCTGTGATTCCAAAGCTGCA into zygotes, which resulted in a 334 bp deletion at Chr 11: 80,692,846-80,693,179 bp (GRCm38/mm10). This deletion includes ENSMUSE00001265867. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Myo1d Mutation: 61 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)