Smarcd3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smarcd3^em1(IMPC)J
• Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775819
• Synonyms: Smarcd3^em1J
• Gene: Smarcd3 Location: Chr5:24797620-24829649 bp, - strand Genetic Position: Chr5, 11.93 cM, cytoband A3
• Alliance: Smarcd3^em1(IMPC)J page
• IMPC: Smarcd3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Smarcd3-7699J-M8045 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCCCTTTCACGCGGGG, GCGACCAAGTCATTCTAGCT, CCGCCCCTCTCCAAGACCCT and CCCACTCATCGCTCAGCGCA, which resulted in a 471 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 24,598,924 bp, CAGGGTTACCAACCCAGGGT, and ending after CAGCGACCAAGTCATTCTAG at 24,598,454 bp (GRCm38/mm10). This mutation deletes exon 2 and 259 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Smarcd3 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)