Acod1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acod1^em1(IMPC)J
• Name: aconitate decarboxylase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775820
• Synonyms: Acod1^em1J
• Gene: Acod1 Location: Chr14:103284448-103294009 bp, + strand Genetic Position: Chr14, 51.67 cM
• Alliance: Acod1^em1(IMPC)J page
• IMPC: Acod1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Acod1-7676J-M9515 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACGATTCTGACAATTTGG, TGAAATTATACCCTAAAAAT, GCAGTGTCGCTTTCCTTGAT and TCGCTTTCCTTGATGGGCAC, which resulted in a 370 bp deletion spanning exon 4 beginning at Chromosome 14 positive strand position 103,051,188 bp, ATTTTTAGGGTATAATTTCA, and ending after TGTGCCCATCAAGGAAAGCG at 103,051,557 bp (GRCm38/mm10). This mutation deletes exon 4 and 164 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 49 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Acod1 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 45 reference(s)