About   Help   FAQ
Acod1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Acod1em1(IMPC)J
Name: aconitate decarboxylase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5775820
Synonyms: Acod1em1J
Gene: Acod1  Location: Chr14:103284448-103294009 bp, + strand  Genetic Position: Chr14, 51.67 cM
Alliance: Acod1em1(IMPC)J page
IMPC: Acod1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Acod1-7676J-M9515 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACGATTCTGACAATTTGG, TGAAATTATACCCTAAAAAT, GCAGTGTCGCTTTCCTTGAT and TCGCTTTCCTTGATGGGCAC, which resulted in a 370 bp deletion spanning exon 4 beginning at Chromosome 14 positive strand position 103,051,188 bp, ATTTTTAGGGTATAATTTCA, and ending after TGTGCCCATCAAGGAAAGCG at 103,051,557 bp (GRCm38/mm10). This mutation deletes exon 4 and 164 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 88 and early truncation 49 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Acod1 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  43 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory