Ano7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ano7^em1(IMPC)J
• Name: anoctamin 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5775821
• Synonyms: Ano7^em1J
• Gene: Ano7 Location: Chr1:93301652-93332025 bp, + strand Genetic Position: Chr1, 47.24 cM
• Alliance: Ano7^em1(IMPC)J page
• IMPC: Ano7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ano7-7738J-M6515 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTGGCAGTGAGTCATCTGA, GCTCCTTGTCCCTCTGGCCA, GGTGACAGCAGGAAGCCGGT and AGATCGATCACAAGGAGACC, which resulted in a 181 bp deletion spanning exon 3 beginning at Chromosome 1 positive strand position 93,377,228 bp, GAGTCATCTGATGGTTGGAT, and ending after GGGGTGACAGCAGGAAGCC at 93,377,408 bp (GRCm38/mm10). This mutation deletes exon 3 and 123 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 15 bp deletion of intronic sequence 38 bp 5-prime of the 181 bp deletion, and an 8 bp deletion of intronic sequence 25 bp after the 181 bp deletion, neither of which is expected to alter the overall outcome of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 36 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ano7 Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)