Ap2b1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ap2b1^em1(IMPC)J
• Name: adaptor-related protein complex 2, beta 1 subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5776619
• Synonyms: Ap2b1^em1J
• Gene: Ap2b1 Location: Chr11:83189850-83295861 bp, + strand Genetic Position: Chr11, 50.3 cM, cytoband B5
• Alliance: Ap2b1^em1(IMPC)J page
• IMPC: Ap2b1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intergenic deletion
• Mutation details: This allele from project Ap2b1-7740J-M6562 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACAAGGCAGCCACTGAAGTA, TTGCAATATAAAATACCATC, GTAAGGGCTGACTGTCCATA and AAGGGCTGACTGTCCATAGG, which resulted in a 247 bp deletion of exon 3 beginning at Chromosome 11 positive strand position 83,316,316 bp, CTTACTTCAGTGGCTGCCTT, and ending after CCCCCCTATGGACAGTCAGC at 83,316,562 bp (GRCm38/mm10). This mutation deletes exon 3 and 141 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ap2b1 Mutation: 74 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)