Muc3a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Muc3a^em1(IMPC)J
• Name: mucin 3A, cell surface associated; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5776697
• Synonyms: Muc3a^em1J
• Gene: Muc3a Location: Chr5:137243270-137246852 bp, - strand Genetic Position: Chr5, Syntenic
• Alliance: Muc3a^em1(IMPC)J page
• IMPC: Muc3a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Muc3a-7685J-F6801 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCCCCTTCACCTTTGTG, CGGGTCCACTGACTGCCCCA, CAGAGCCTAGCTTTAGTGAA and TGCGAGGGCGGGCTTTTCCA, which resulted in a 398 bp deletion in exon 3 beginning at Chromosome 5 negative strand position 137,211,645 bp, CGACCTTGGAAAAGCCCGCC, and ending after AGGGTGGAGACGACTGCAAT at 137,211,248 bp (GRCm38/mm10). In addition there is a 2 bp intron insertion tc after the deletion which will not effect the mutation. This mutation deletes exon 3 and 235 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 40 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Muc3a Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)