Prpf4b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prpf4b^em1(IMPC)J
• Name: pre-mRNA processing factor 4B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5779705
• Synonyms: Prpf4b^-, Prpf4b^em1J
• Gene: Prpf4b Location: Chr13:35059285-35090047 bp, + strand Genetic Position: Chr13, 14.21 cM, cytoband A5
• Alliance: Prpf4b^em1(IMPC)J page
• IMPC: Prpf4b gene page

Prpf4b^em1(IMPC)J/Prpf4b^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5, appearing as early blastocysts/late morulae, but not at E7.5. Mutants fail to hatch from the zona pellucida with apparent cell death.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Prpf4b-7776J-M6407 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTAGACAACTTTGAGCTT, CTTGTTCACTGCACCAAAAC, CCTGATTACCCAGCACTAGA and GTGTAAGCTCTTCTAGTGAC, which resulted in a 310 bp deletion across exon 5 beginning at Chromosome 13 positive strand position 34,889,350 bp, CTGTTTTGGTGCAGTGAACA, and ending after GTAGTGACAGTAACCAGTCA at 34,889,659 bp (GRCm38/mm10). This mutation deletes exon 5 and 228 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 522 and early truncation 42 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prpf4b Mutation: 48 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)