About   Help   FAQ
Lgals4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Lgals4em1(IMPC)J
Name: lectin, galactose binding, soluble 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5779710
Synonyms: Lgals4em1J
Gene: Lgals4  Location: Chr7:28533559-28541128 bp, + strand  Genetic Position: Chr7, 16.94 cM
Alliance: Lgals4em1(IMPC)J page
IMPC: Lgals4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Lgals4-7682J-F3313 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCTCAGTCCCTTAAGCGG, GACCAGGTGAAGAGCCTCAG, GCACTTCCCCGCTCACCCCA and TCCCTAACTCTGATGCCAGG, which resulted in a 278 bp deletion in exon 2 beginning at Chromosome 7 positive strand position 28,834,332 bp, CTCCTTACCCTAAGTCTCAT, and ending after TTCCCTAACTCTGATGCCAG at 28,834,609 bp (GRCm38/mm10). This mutation deletes exon 2 and 189 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lgals4 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory