Lgals4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lgals4^em1(IMPC)J
• Name: lectin, galactose binding, soluble 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5779710
• Synonyms: Lgals4^em1J
• Gene: Lgals4 Location: Chr7:28533559-28541128 bp, + strand Genetic Position: Chr7, 16.94 cM
• Alliance: Lgals4^em1(IMPC)J page
• IMPC: Lgals4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Lgals4-7682J-F3313 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCTCAGTCCCTTAAGCGG, GACCAGGTGAAGAGCCTCAG, GCACTTCCCCGCTCACCCCA and TCCCTAACTCTGATGCCAGG, which resulted in a 278 bp deletion in exon 2 beginning at Chromosome 7 positive strand position 28,834,332 bp, CTCCTTACCCTAAGTCTCAT, and ending after TTCCCTAACTCTGATGCCAG at 28,834,609 bp (GRCm38/mm10). This mutation deletes exon 2 and 189 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lgals4 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)