Ssx2ip^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ssx2ip^em1(IMPC)J
• Name: SSX family member 2 interacting protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5779850
• Synonyms: Ssx2ip^em1J
• Gene: Ssx2ip Location: Chr3:146110397-146145899 bp, + strand Genetic Position: Chr3, 71.03 cM
• Alliance: Ssx2ip^em1(IMPC)J page
• IMPC: Ssx2ip gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ssx2ip-7709J-F9191 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATACACGTCTATGACAAAA, AGAATCTTTGGTAATGGAGA, TTATGTACCACAAAATGTCG and CATGCAGAGCCACCGAGCCT, which resulted in a 368 bp deletion in exon 4 beginning at Chromosome 3 positive strand position 146,418,140 bp, ATGAACTTGTGCCATTTTGT, and ending after CCACAAAATGTCGAGGCCAC at 146,418,507 bp (GRCm38/mm10). This mutation deletes exon 3 and 198 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ssx2ip Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)