Wdr45^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr45^em1(IMPC)J
• Name: WD repeat domain 45; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5779851
• Synonyms: Wdr45^em1J
• Gene: Wdr45 Location: ChrX:7588212-7594439 bp, + strand Genetic Position: ChrX, 3.48 cM
• Alliance: Wdr45^em1(IMPC)J page
• IMPC: Wdr45 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Wdr45-7725J-M3004 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTTGGCAAGACCAAAGTTT, CAAGTGGTTGAGATCCTGTG, GGGCAACTGCCAGCGAGGCG and GAGGTTACCTTACTTGTTGT, which resulted in a 252 bp deletion in exon 5 beginning at Chromosome X positive strand position 7,725,839 bp, GTGGTTGAGATCCTGTGAGG, and ending after GCAGGAAGTTCCCACAACAA at 7,726,090 bp (GRCm38/mm10). This mutation deletes exon 5 and 146 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 5 bp deletion (ctcgc) 46 bp after the 252 bp deletion that will not alter the results of the 252 bp deletion, which is predicted to cause a change of amino acid sequence after residue 78 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Wdr45 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)