Tuba8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tuba8^em1(IMPC)J
• Name: tubulin, alpha 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5779854
• Synonyms: Tuba8^em1J
• Gene: Tuba8 Location: Chr6:121187655-121203813 bp, + strand Genetic Position: Chr6, 57.15 cM, cytoband F1
• Alliance: Tuba8^em1(IMPC)J page
• IMPC: Tuba8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tuba8-7807J-M772 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TACATCACCCCACAAACAGG, TTCCTCACATCCAATGCACA, GCTCCCCAAGGAGCTAAGAG and TGGCCAAGAGAGCATTCTGC, which resulted in a 480 bp deletion including exon 2 beginning at Chromosome 6 positive strand position 121,220,250 bp, CACCTCCTGTTTGTGGGGTG, and ending after CTCCGTGAGACCTCTCTTAG at 121,220,729 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tuba8 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)