C1qc^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: C1qc^em1(IMPC)J
• Name: complement component 1, q subcomponent, C chain; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5779860
• Synonyms: C1qc^em1J
• Gene: C1qc Location: Chr4:136617115-136620225 bp, - strand Genetic Position: Chr4, 69.05 cM
• Alliance: C1qc^em1(IMPC)J page
• IMPC: C1qc gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project C1qc-7743J-M6896 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGTTCGTGCCGAGTGAA, ACTCGCACACTAGCTGCTAC, GACATGATAGGGCAGAAGGC and AGATAGCTCTGCCCAGGTGG, which resulted in a 989 bp deletion in exon 3 beginning at Chromosome 4 negative strand position 136,890,711 bp, CCTGGGCAGAGCTATCTGGA, and ending after GGGTGTTCGTGCCGAGTGAA at 136,889,723 bp (GRCm38/mm10). This mutation deletes exon 3 and 193 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp insertion (A) and 5 bp deletion (ggagc) 89 bp after the 989 bp deletion that are not predicted alter the results of the mutation. If read through after exon 2 occurs, a change of amino acid sequence after residue 62 and early truncation 28 amino acids later is predicted. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any C1qc Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)