Telo2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Telo2^em1(IMPC)J
• Name: telomere maintenance 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5781312
• Synonyms: Telo2^em1J
• Gene: Telo2 Location: Chr17:25318544-25334941 bp, - strand Genetic Position: Chr17, 12.53 cM, cytoband A3.3
• Alliance: Telo2^em1(IMPC)J page
• IMPC: Telo2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Telo2-7804J-9704M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCTCAGAAATGTGGCG, CCATGAGAGATGTCGAGGCA, AAGGCAACACTAGGCAGAGG and CAACACTAGGCAGAGGGGGG, which resulted in a 465 bp deletion around exon 3 beginning at Chromosome 17 negative strand position 25,113,380 bp, GGCTTATTTTACCACTGAGC, and ending after CTTCTCTTCTCAGAAATGTG at 25,112,916 bp (GRCm38/mm10). This mutation deletes exon 3 and 187 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an insertion of two bp (AA) at the site of the mutation that will not effect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 112 and early truncation 55 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Telo2 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)