Tusc1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tusc1^em1(IMPC)J
• Name: tumor suppressor candidate 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5784541
• Synonyms: Tusc1^em1J
• Gene: Tusc1 Location: Chr4:93222385-93223748 bp, - strand Genetic Position: Chr4, 43.25 cM, cytoband C5
• Alliance: Tusc1^em1(IMPC)J page
• IMPC: Tusc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Tusc1-7713J-M6853 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCCATGATCCGGACGTTCCG, GTTGGTGGCGGGCTCGTCCG, AGCGGGACCGGCAGAACGCG and GGAGCGCTTCGCCGACCTGG, which resulted in a 413 bp deletion in exon 1 beginning at Chromosome 4 negative strand position 93,335,287 bp, GCCGCGCGGGCGGGGCCCGG, and ending after GCCCGCCGGGAGCCATCGAG at 93,334,875 bp (GRCm38/mm10). This mutation deletes 413 bp in exon 1 as well as an additional 3 bp (gtt) in the exon 50 bp after the 413 bp deletion, and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tusc1 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)