Snapc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Snapc2^em1(IMPC)J
• Name: small nuclear RNA activating complex, polypeptide 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5784546
• Synonyms: Snapc2^-, Snapc2^em1J
• Gene: Snapc2 Location: Chr8:4303102-4306220 bp, + strand Genetic Position: Chr8, 1.99 cM
• Alliance: Snapc2^em1(IMPC)J page
• IMPC: Snapc2 gene page

Snapc2^em1(IMPC)J/Snapc2^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and never reach blastocyst stage in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Snapc2-7778J-F6434 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATCACCTTCAGAGCGTGCAG, GTCCATTCTAGGTCTAGCAG, ATACTGTGTTTGTGTTGCGA and GTTGCGAGGGGGTTGTCTGG, which resulted in a 503 bp deletion around exon 4 beginning at Chromosome 8 positive strand position 4,254,919 bp, GGTCCATTCTAGGTCTAGCA, and ending after TACTGTGTTTGTGTTGCGAG at 4,255,421 bp (GRCm38/mm10). This mutation deletes exon 4 and 121 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 124 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Snapc2 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)