Krt90^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt90^em1(IMPC)J
• Name: keratin 90; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5784550
• Synonyms: Krt90^em1J
• Gene: Krt90 Location: Chr15:101460791-101471385 bp, - strand Genetic Position: Chr15, 56.9 cM
• Alliance: Krt90^em1(IMPC)J page
• IMPC: Krt90 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Krt90-7840J-M3816 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCTGGGCCACATAGATGG, TAGAGAACTGCTGAATTCAG, GGACACCCAATAAATAGTAA and CTGAGTTTGGGGGTCATGCA, which resulted in a 327 bp deletion around exon 2 beginning at Chromosome 15 negative strand position 101,560,724 bp, GCAGGGTCCCTTACTATTTA, and ending after AGTGAGTGGGTCCTCCATCT at 101,560,398 bp (GRCm38/mm10). This mutation deletes exon 2 and 118 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 4 bp insertion (acag) and a 22 bp deletion (gaattcagcagttctctacatc) 71 bp after the 327 bp deletion that should not alter the results of the 327 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 162 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Krt90 Mutation: 29 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)