Acy1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acy1^em1(IMPC)J
• Name: aminoacylase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5784639
• Synonyms: Acy1^em1J
• Gene: Acy1 Location: Chr9:106310180-106315518 bp, - strand Genetic Position: Chr9, 57.49 cM
• Alliance: Acy1^em1(IMPC)J page
• IMPC: Acy1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Acy1-7841J-M3824 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACAAAGTGTCCCCAACCCA, CTGGAGCCTTGAGCAGGGTG, CTGCTTTTGCTGGTACCCAC and TATACATCTCTGGGCTGCCT, which resulted in a 214 bp deletion around exon 3 beginning at Chromosome 9 negative strand position 106,437,075 bp, GAACGCAGATGCAGATGTTT, and ending after TGGAGCCTTGAGCAGGGTGG at 106,436,862 bp (GRCm38/mm10). This mutation deletes exon 3 and 150 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is another 23 bp deletion (ggttggggacactttgtcccctg) in intron 4, 7 bp after the 214 bp deletion, that will not alter the result of the 214 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 40 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Acy1 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)