Rbm25^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbm25^em1(IMPC)J
• Name: RNA binding motif protein 25; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5784893
• Synonyms: Rbm25^em1J
• Gene: Rbm25 Location: Chr12:83678990-83729901 bp, + strand Genetic Position: Chr12, 38.81 cM, cytoband D3
• Alliance: Rbm25^em1(IMPC)J page
• IMPC: Rbm25 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Rbm25-7449J-M3912 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAACATTGATGAACCCAGA, CAGCAAGGCAAAATGATTAA, AGTGTTTTATCTACCCACAG and GTCATTGTAATATGTGCTTG, which resulted in a 340 bp deletion around ENSMUSE00001286618 (exon 6) beginning at Chromosome 12 positive strand position 84,992,175 bp, GCTGTATTTTTTCATGTTTTT, and ending after AATATGTGCTTGTGGCTTAT at 84,992,514 bp (GRCm38/mm10). This mutation deletes exon 6 and 182 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (TTTTTTTTTT) and 1bp insertion C in the intron 136 bp before the 340 bp deletion that is not expected to have an effect on the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 127 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rbm25 Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)