Kctd9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kctd9^em1(IMPC)J
• Name: potassium channel tetramerisation domain containing 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5784897
• Synonyms: Kctd9^em1J
• Gene: Kctd9 Location: Chr14:67953536-67979760 bp, + strand Genetic Position: Chr14, 34.66 cM
• Alliance: Kctd9^em1(IMPC)J page
• IMPC: Kctd9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Kctd9-7773J-M6328 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGCGCTGAATCTCCTCAA, GCACAGAGTAATTGCCTATC, ACTAGTGACAGCCTTAGAAA and CAGCAGTGACACTACAGCAT, which resulted in a 277 bp deletion around exon 2 beginning at Chromosome 14 positive strand position 67,724,474 bp, CTCCTCAAGGGTCTCTTAAG, and ending after TGAGCTGTCTGTCACCTATG at 67,724,750 bp (GRCm38/mm10). This mutation deletes exon 2 and 155 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single base pair (C) deletion in the intron 42 bp before the 277 bp deletion that is not expected to alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 16 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kctd9 Mutation: 25 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)