Zfp612^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp612^em1(IMPC)J
• Name: zinc finger protein 612; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5787575
• Synonyms: Zfp612^em1J
• Gene: Zfp612 Location: Chr8:110806378-110819373 bp, + strand Genetic Position: Chr8, 57.41 cM
• Alliance: Zfp612^em1(IMPC)J page
• IMPC: Zfp612 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: This allele from project Zfp612-7727J-M3059 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGCTCAGGCCCTAAGTAAAG, GAGCACAAAGTTAGTAACAA, GCGCCTTTCTTCCTAAGAAG and GTTTGGTAATTCTTTATGAG, which resulted in a 365 bp deletion around exon 3 beginning at Chromosome 8 positive strand position 110,083,490 bp, ATCCCATAGTTTACTTCCCC, and ending after CTTTCTTCCTAAGAAGTGGT at 110,083,854 bp (GRCm38/mm10). This mutation deletes exon 3 and 238 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 62 bp insertion at the same site, which was inserted from 824 bp upstream of the deletion, as well as a 20 bp deletion (tttggtaattctttatgagt) and 2 bp insertion (AG) 9 bp after the 365 bp deletion that will not alter the result of the exon deletion. This 365 bp deletion is predicted to cause a change of amino acid sequence after residue 8 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp612 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)