Fam114a1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam114a1^em1(IMPC)J
• Name: family with sequence similarity 114, member A1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788340
• Synonyms: Fam114a1^em1J
• Gene: Fam114a1 Location: Chr5:65127459-65199217 bp, + strand Genetic Position: Chr5, 33.55 cM, cytoband C3.3
• Alliance: Fam114a1^em1(IMPC)J page
• IMPC: Fam114a1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Fam114a1-7878J-M7854 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAAGCAACCACATCTCCC, AGATGTGGTTGCTTGGTGGT, TTTGACATAGCGTACATTGA and ATGGAGTTTAACGTTTGCTC, which resulted in a 314 bp deletion beginning at Chromosome 5 positive strand position 64,995,684 bp, GGGAGATGTGGTTGCTTGGT, and ending after GGAGTTTAACGTTTGCTCAG at 64,995,997 bp (GRCm38/mm10). This mutation deletes exon 3 and 226 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fam114a1 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)