Dlat^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dlat^em1(IMPC)J
• Name: dihydrolipoamide S-acetyltransferase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788343
• Synonyms: Dlat^em1J
• Gene: Dlat Location: Chr9:50545933-50571080 bp, - strand Genetic Position: Chr9, 27.75 cM
• Alliance: Dlat^em1(IMPC)J page
• IMPC: Dlat gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dlat-7876J-M7804 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTTTTATAAAATATGACCC, CAGCTCAGAACTGACACGTG, GACCTTGTCACCCATCACAA and CTGAATGCTTTTATGCGTCC, which resulted in a 325 bp deletion beginning at Chromosome 9 negative strand position 50,653,854 bp, TTGTGATGGGTGACAAGGTC, and ending after TTGCTGCCTGGGTCATATTT at 50,653,530 bp (GRCm38/mm10). This mutation deletes exon 5 and 198 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 7 bp (cgtgtca) intronic deletion 24 bp after the 325 bp deletion that will not alter the result of the mutation. The 325 bp deletion is predicted to cause a change of amino acid sequence after residue 219 and early truncation 30 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dlat Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)