Foxk2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Foxk2^em1(IMPC)J
• Name: forkhead box K2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788415
• Synonyms: Foxk2^em1J
• Gene: Foxk2 Location: Chr11:121150816-121200722 bp, + strand Genetic Position: Chr11, 85.15 cM
• Alliance: Foxk2^em1(IMPC)J page
• IMPC: Foxk2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Foxk2-7879J-M7860 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATACCATGCTTCCTTTAAA, TTTCCTGACCCAGCTCGTTA, TTTATAGTCGTGGATTTGGG and GATACTGGTAACTAGTCCTT, which resulted in a 324 bp deletion beginning at Chromosome 11 positive strand position 121,287,817 bp GGCAAACCACATAATAAATA, and ending after ATACTGGTAACTAGTCCTTT at 121,288,140 bp (GRCm38/mm10). This mutation deletes exon 3 and 176 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 195 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Foxk2 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)