About   Help   FAQ
Foxk2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Foxk2em1(IMPC)J
Name: forkhead box K2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788415
Synonyms: Foxk2em1J
Gene: Foxk2  Location: Chr11:121150816-121200722 bp, + strand  Genetic Position: Chr11, 85.15 cM
Alliance: Foxk2em1(IMPC)J page
IMPC: Foxk2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Foxk2-7879J-M7860 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATACCATGCTTCCTTTAAA, TTTCCTGACCCAGCTCGTTA, TTTATAGTCGTGGATTTGGG and GATACTGGTAACTAGTCCTT, which resulted in a 324 bp deletion beginning at Chromosome 11 positive strand position 121,287,817 bp GGCAAACCACATAATAAATA, and ending after ATACTGGTAACTAGTCCTTT at 121,288,140 bp (GRCm38/mm10). This mutation deletes exon 3 and 176 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 195 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Foxk2 Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory