Cxcl2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cxcl2^em1(IMPC)J
• Name: C-X-C motif chemokine ligand 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788425
• Synonyms: Cxcl2^em1J
• Gene: Cxcl2 Location: Chr5:91051758-91053797 bp, + strand Genetic Position: Chr5, 44.78 cM
• Alliance: Cxcl2^em1(IMPC)J page
• IMPC: Cxcl2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cxcl2-7870J-M7781 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGTGCATAAAAGGAGCTCT, CGTGCATAAAAGGAGCTCTC, GGGGATCATTATAAGGCACG and TCTTTAGGGTGAGCATGGGG, which resulted in a 510 bp deletion beginning at Chromosome 5 positive strand position 90,903,835 bp, ATCGTGCATAAAAGGAGCTC, and ending after TGCCTTATAATGATCCCCAC at 90,904,344 bp (GRCm38/mm10). This mutation deletes exons 1 and 2 and 235 bp of flanking intronic sequence including the transcriptional start, splice acceptor and donor, and is predicted to create a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cxcl2 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)