Cdkn3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdkn3^em1(IMPC)J
• Name: cyclin dependent kinase inhibitor 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788504
• Synonyms: Cdkn3^em1J
• Gene: Cdkn3 Location: Chr14:46997912-47008987 bp, + strand Genetic Position: Chr14, 24.28 cM, cytoband C1
• Alliance: Cdkn3^em1(IMPC)J page
• IMPC: Cdkn3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cdkn3-7867J-F7751 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAATCATGGATCAGCTATG, ACTGCAAATATTAATTCAGT, TTTCCCCCCTCAATGTGTAA and TTTAATCCTTTACACATTGA, which resulted in a 353 bp deletion beginning at Chromosome 14 positive strand position 46,762,437 bp TAATTCAGTGGGTGTTTAAT, and ending after CTTTTAATCCTTTACACATTG at 46,762,789 bp (GRCm38/mm10). This mutation deletes exon 2 and 270 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (A) inserted at the site of the deletion and a single bp deletion (A) 9 bp after the 353 bp deletion, which will not effect the results of that deletion. This mutation is predicted to cause a change of amino acid sequence after residue 3 and early truncation 20 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cdkn3 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)