Ncbp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncbp1^em1(IMPC)J
• Name: nuclear cap binding protein subunit 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788506
• Synonyms: Ncbp1^em1J
• Gene: Ncbp1 Location: Chr4:46138732-46172403 bp, + strand Genetic Position: Chr4, 24.49 cM
• Alliance: Ncbp1^em1(IMPC)J page
• IMPC: Ncbp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ncbp1-7919J-M3862 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCTGTTTTAACTAAGCT, TAGCTTAGTTAAAACAGGAT, TTAATTTCTGAAGTTGTCCT and CAATTACAACCCTAACCCCT, which resulted in a 274 bp deletion beginning at Chromosome 4 positive strand position 46,144,660 bp GATTGGTTAAGAACTACTCT, and ending after TTTGATTAATTTCTGAAGTTG at 46,144,933 bp (GRCm38/mm10). This mutation deletes exon 2 and 185 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 18 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ncbp1 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)