Nrap^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nrap^em1(IMPC)J
• Name: nebulin-related anchoring protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788510
• Synonyms: Nrap^em1J
• Gene: Nrap Location: Chr19:56308473-56378466 bp, - strand Genetic Position: Chr19, 51.8 cM
• Alliance: Nrap^em1(IMPC)J page
• IMPC: Nrap gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Nrap-7921J-M3386 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCTCGGGAGAGGTGCTACT, GCTCGCCACTGCATGACTTT, CCTGGAGGAGGACAGCTAAT and AGACTTTCAGGTTAAAAAGT, which resulted in a 248 bp deletion beginning at Chromosome 19 negative strand position 56,389,523 bp GAGGACAGCTAATTGGCAGA, and ending after CGAGTAGCACCTCTCCCGAG at 56,389,276 bp (GRCm38/mm10). This mutation deletes exon 2 and 153 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 24 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nrap Mutation: 96 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)