Ccdc146^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc146^em1(IMPC)J
• Name: coiled-coil domain containing 146; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5788754
• Synonyms: Ccdc146^em1J
• Gene: Ccdc146 Location: Chr5:21497959-21629675 bp, - strand Genetic Position: Chr5, 9.83 cM, cytoband A3
• Alliance: Ccdc146^em1(IMPC)J page
• IMPC: Ccdc146 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ccdc146-7865J-F7713 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGGGCAAAGATCAGAGTTC, AGGTTGTGAATGTGTGAAGA, AGTAACCTATGTGCATCCAC and GATCACTGTTCGTATGCCTG, which resulted in a 297 bp deletion beginning at Chromosome 5 negative strand position 21,333,199 bp CACAGGCATATGGACAGTGA, and ending after TGGGGCAAAGATCAGAGTTC at 21,332,903 bp (GRCm38/mm10). This mutation deletes exon 3 and 214 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (G) deleted 40 bp before the 297 bp deletion that will not have any effect on the exon deletion that is predicted to cause a change of amino acid sequence after residue 74 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc146 Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)