About   Help   FAQ
Wdr81em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr81em1(IMPC)J
Name: WD repeat domain 81; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5788768
Synonyms: Wdr81em1J
Gene: Wdr81  Location: Chr11:75331770-75345543 bp, - strand  Genetic Position: Chr11, 45.89 cM
Alliance: Wdr81em1(IMPC)J page
IMPC: Wdr81 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Wdr81-7808J-F751 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCCGGGGTTTGACGAACCA, CCTGGAACCCCCAAGACCTG, TGGGTTTTCTTGGGTAAGTG and CAGCGTTGAGAAGCCAGTGG, which resulted in a 290 bp deletion beginning at Chromosome 11 negative strand position 75,449,570 bp CTGGCTTCTCAACGCTGCTG, and ending after GATCCAAGGACCAGCCCCAG at 75,449,281 bp (GRCm38/mm10). This mutation deletes exon 3 and 99 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 1252 and early truncation 34 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Wdr81 Mutation:  56 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory