Ncbp2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ncbp2^em1(IMPC)J
• Name: nuclear cap binding protein subunit 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5789874
• Synonyms: Ncbp2^em1J
• Gene: Ncbp2 Location: Chr16:31767364-31777290 bp, + strand Genetic Position: Chr16, 22.4 cM
• Alliance: Ncbp2^em1(IMPC)J page
• IMPC: Ncbp2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ncbp2-7920J-M3809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAATCTCTATGTAAATAATC, TCTATGTAAATAATCTGGTT, CCTGAACTGAATCTCTGCCT and CAGGTCTTTTCGTCAGTTTG, which resulted in a 326 bp deletion beginning at Chromosome 16 positive strand position 31,956,177 bp GTAAATAATCTGGTTAGGTT, and ending after TACAGGTCTTTTCGTCAGTTT at 31,956,502 bp (GRCm38/mm10). This mutation deletes exon 3 and 187 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 87 and early truncation 23 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ncbp2 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)