Gas7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gas7^em1(IMPC)J
• Name: growth arrest specific 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5789880
• Synonyms: Gas7^em1J
• Gene: Gas7 Location: Chr11:67345917-67575800 bp, + strand Genetic Position: Chr11, 41.13 cM
• Alliance: Gas7^em1(IMPC)J page
• IMPC: Gas7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gas7-7889J-F7372 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGCAACCCTGGGATGAGGA, CATGTGGCAGGGCCATCTAT, TAACAGTTCCTAATGATAGA and CTATTAGTGGAAAGAATCTC, which resulted in a 320 bp deletion beginning at Chromosome 11 negative strand position 67,643,151 bp GATGGCCCTGCCACATGAGA, and ending after CTGCTATTAGTGGAAAGAAT at 67,643,470 bp (GRCm38/mm10). This mutation deletes exon 4 and 234 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 31 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gas7 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)