Shisa7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shisa7^em1(IMPC)J
• Name: shisa family member 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5789901
• Synonyms: Shisa7^em1J
• Gene: Shisa7 Location: Chr7:4828551-4847695 bp, - strand Genetic Position: Chr7, 2.79 cM
• Alliance: Shisa7^em1(IMPC)J page
• IMPC: Shisa7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Shisa7-7952J-M6633 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAGAAATGTCCACAGCTGA, AGGATTGAGAGTGTCACATG, CTGTGGATGCCCTAAAGAAG and GCAGAGATGTGGTCCAGTTT, which resulted in a 399 bp deletion beginning at Chromosome 7 negative strand position 4,834,509 bp, CTGGACCACATCTCTGCACT, and ending after ATTCCAGTCTCCATCCATCA at 4,834,111 bp (GRCm38/mm10). This mutation deletes exon 3 and 244 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 227 and early truncation 32 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Shisa7 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)