Mpped2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mpped2^em1(IMPC)J
• Name: metallophosphoesterase domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5789904
• Synonyms: Mpped2^em1J
• Gene: Mpped2 Location: Chr2:106523614-106698701 bp, + strand Genetic Position: Chr2, 55.8 cM
• Alliance: Mpped2^em1(IMPC)J page
• IMPC: Mpped2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mpped2-7894J-M7436 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTATGATGACTATTACGA, CACCCAAACAGTCTAACGCA, AGACCGGGAAAGGTTAATTG and ATTTCTTGTATGATATGCTG, which resulted in a 356 bp deletion beginning at Chromosome 2 positive strand position 106,744,649bp CGAGGGTTCTGACATGTTTA, and ending after ATTTCTTGTATGATATGCTG at 106,745,004 bp (GRCm38/mm10). This mutation deletes exon 3 and 174 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mpped2 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)