Slc25a46^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc25a46^em1(IMPC)J
• Name: solute carrier family 25, member 46; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5790100
• Synonyms: Slc25a46^em1J
• Gene: Slc25a46 Location: Chr18:31713217-31743585 bp, - strand Genetic Position: Chr18, 17.79 cM
• Alliance: Slc25a46^em1(IMPC)J page
• IMPC: Slc25a46 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Slc25a46-7953J-M6621 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCTGTTAATAAAACCTAA, TCACTTTGAGGTTTATGCAG, TCAAATTCTGATATGGAACA and GTTTAAATAGTGAATGACTC, which resulted in a 365 bp deletion beginning at Chromosome 18 negative strand position 31,607,404 bp CAGAGTCATTCACTATTTAA, and ending after AGTCATTCCACTGCATAAAC at 31,607,040 bp (GRCm38/mm10). This mutation deletes exon 2 and 322 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 94 and early truncation 70 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc25a46 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)