Rab11bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Rab11bem1(IMPC)J |
Name: |
RAB11B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5790204 |
Synonyms: |
Rab11bem1J |
Gene: |
Rab11b Location: Chr17:33961458-33979460 bp, - strand Genetic Position: Chr17, 17.98 cM
|
Alliance: |
Rab11bem1(IMPC)J page
|
IMPC: |
Rab11b gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Rab11b-7933J-M7053 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGGGGCTGAACTAGAGCA, GTAGGGGCTGAACTAGAGCA, TTACCAGTGTGTCCCAGCGT and CACCCAGCAAACCTGCATGG, which resulted in a 549 bp deletion beginning at Chromosome 17 negative strand position 33,750,102 bp CCAGCGTGGGAAAATCCGTG, and ending after TTCCATTTTCACCCAACCTC at 33,749,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 353 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 13 and early truncation 18 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|