About   Help   FAQ
Rab11bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab11bem1(IMPC)J
Name: RAB11B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5790204
Synonyms: Rab11bem1J
Gene: Rab11b  Location: Chr17:33961458-33979460 bp, - strand  Genetic Position: Chr17, 17.98 cM
Alliance: Rab11bem1(IMPC)J page
IMPC: Rab11b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab11b-7933J-M7053 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGGGGCTGAACTAGAGCA, GTAGGGGCTGAACTAGAGCA, TTACCAGTGTGTCCCAGCGT and CACCCAGCAAACCTGCATGG, which resulted in a 549 bp deletion beginning at Chromosome 17 negative strand position 33,750,102 bp CCAGCGTGGGAAAATCCGTG, and ending after TTCCATTTTCACCCAACCTC at 33,749,554 bp (GRCm38/mm10). This mutation deletes exon 2 and 353 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 13 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rab11b Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory