Serp2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serp2^em1(IMPC)J
• Name: stress-associated endoplasmic reticulum protein family member 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5790709
• Synonyms: Serp2^em1J
• Gene: Serp2 Location: Chr14:76770254-76794329 bp, - strand Genetic Position: Chr14, 40.44 cM
• Alliance: Serp2^em1(IMPC)J page
• IMPC: Serp2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Serp2-7951J-M6651 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGAGGACAGCGGAGAACAC, CCTTAAACCTTAATCTTTAT, GTACGTGCTGAGGCTCCTAC and GACAGACTCTTGGATCCTAC, which resulted in a 222 bp deletion beginning at Chromosome 14 negative strand position 76,550,173 bp GATCCAAGAGTCTGTCACTC, and ending after TCACTGAATTATAGCCTGTG at 76,549,952 bp (GRCm38/mm10). This mutation deletes exon 2 and 149 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Serp2 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)