Rprd1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rprd1a^em1(IMPC)J
• Name: regulation of nuclear pre-mRNA domain containing 1A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5792573
• Synonyms: Rprd1a^em1J
• Gene: Rprd1a Location: Chr18:24618017-24663261 bp, - strand Genetic Position: Chr18, 13.18 cM
• Alliance: Rprd1a^em1(IMPC)J page
• IMPC: Rprd1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rprd1a-7936J-F7112 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGTTATGTGGCTGATGAG, AGCGTTCATACAGTGTGTGA, CGCTGCTACTAACATCTCCA and GATGAGTGTGTTCGGAGAAG, which resulted in a 333 bp deletion beginning at Chromosome 18 negative strand position 24,510,041 bp, TAGCAGCGACGTGATGAGTG, and ending after TAAAGCGTTCATACAGTGTG at 24,509,709 bp (GRCm38/mm10). This mutation deletes exon 2 and 203 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (A) at the site of the deletion and another insertion (T) 37 bp before the 333 bp deletion that will not alter the result of the mutation. This 333 bp deletion is predicted to cause a change of amino acid sequence after residue 50 and early truncation 28 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rprd1a Mutation: 52 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)