About   Help   FAQ
Tubgcp4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tubgcp4em1(IMPC)J
Name: tubulin, gamma complex component 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5792574
Synonyms: Tubgcp4-, Tubgcp4em1J
Gene: Tubgcp4  Location: Chr2:121001135-121029251 bp, + strand  Genetic Position: Chr2, 60.37 cM, cytoband F1
Alliance: Tubgcp4em1(IMPC)J page
IMPC: Tubgcp4 gene page
Tubgcp4em1(IMPC)J/Tubgcp4em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida with apparent cell death.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tubgcp4-7966J-M7404 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACTATATAGACATCTTGGG, TTCTGTAACCTAGATTGATA, TCCGTAAGTATTGGGAATAG and TCCCAATACTTACGGAAGCC, which resulted in a 204 bp deletion beginning at Chromosome 2 positive strand position 121,178,575 bp GGGAGGGACTATATTAGCTA, and ending after GGCTTCCGTAAGTATTGGGA at 121,178,778 bp (GRCm38/mm10). This mutation deletes exon 6 and 124 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tubgcp4 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory