Tubgcp4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tubgcp4^em1(IMPC)J
• Name: tubulin, gamma complex component 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5792574
• Synonyms: Tubgcp4^-, Tubgcp4^em1J
• Gene: Tubgcp4 Location: Chr2:121001135-121029251 bp, + strand Genetic Position: Chr2, 60.37 cM, cytoband F1
• Alliance: Tubgcp4^em1(IMPC)J page
• IMPC: Tubgcp4 gene page

Tubgcp4^em1(IMPC)J/Tubgcp4^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida with apparent cell death.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tubgcp4-7966J-M7404 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACTATATAGACATCTTGGG, TTCTGTAACCTAGATTGATA, TCCGTAAGTATTGGGAATAG and TCCCAATACTTACGGAAGCC, which resulted in a 204 bp deletion beginning at Chromosome 2 positive strand position 121,178,575 bp GGGAGGGACTATATTAGCTA, and ending after GGCTTCCGTAAGTATTGGGA at 121,178,778 bp (GRCm38/mm10). This mutation deletes exon 6 and 124 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tubgcp4 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)