Rps6ka1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rps6ka1^em1(IMPC)J
• Name: ribosomal protein S6 kinase polypeptide 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5792822
• Synonyms: Rps6ka1^em1J
• Gene: Rps6ka1 Location: Chr4:133574601-133615108 bp, - strand Genetic Position: Chr4, 66.37 cM, cytoband D3
• Alliance: Rps6ka1^em1(IMPC)J page
• IMPC: Rps6ka1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rps6ka1-7938J-F7135 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGGATCACAGAGCCCGTG, AAAGAACTGAGGCTGGGCTT, AGTGACTTAGATGATCCCTG and AGTGACTTAGATGATCCCTG, which resulted in a 308 bp deletion beginning at Chromosome 4 negative strand position 133,871,775 bp GTCCCCTTGATCTACTGAGG, and ending after GCTGCAGGATCACAGAGCCC at 133,871,468bp (GRCm38/mm10). This mutation deletes exon 4 and 226 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 16 amino acids later. There is an additional single bp (T) deleted 60 bp after the 303 bp deletion that is not expected to alter the results of the exon deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rps6ka1 Mutation: 74 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)