Tubb2a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tubb2a^em1(IMPC)J
• Name: tubulin, beta 2A class IIA; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5795759
• Synonyms: Tubb2a^em1J
• Gene: Tubb2a Location: Chr13:34258261-34261991 bp, - strand Genetic Position: Chr13, 14.03 cM
• Alliance: Tubb2a^em1(IMPC)J page
• IMPC: Tubb2a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tubb2a-7712J-F7081 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCCTTGTCTGCATGCTGGT, CTGCTTTCTCTGTCACGGTA, CTGTCACCAGAAAGACAGCA and AGAGATTCTAAGCATGATGT, which resulted in a 170 bp deletion beginning at Chromosome 13 negative strand position 34,076,680 bp ATGTGGGATTGTCTTCATTT, and ending after GTCTCGCTTTCCATACCGTG at 34,076,511 bp (GRCm38/mm10). This mutation deletes exon 2 and 61 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tubb2a Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)