Tbc1d31^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbc1d31^em1(IMPC)J
• Name: TBC1 domain family, member 31; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5795760
• Synonyms: Tbc1d31^em1J
• Gene: Tbc1d31 Location: Chr15:57775595-57833463 bp, + strand Genetic Position: Chr15, 24.08 cM
• Alliance: Tbc1d31^em1(IMPC)J page
• IMPC: Tbc1d31 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tbc1d31-7960J-M8930 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGGTCACAAACTTTACAG, GAAATGGCTGTATTAGTATC, AGCTTCAGAAGGCAAACAGG and CTGAGGCAACACAGACTGGG, which resulted in a 170 bp deletion beginning at Chromosome 15 negative strand position 57,920,067 bp GCAAACAGGAGGACTTCTTA, and ending after GCTGTATTAGTATCAGGAAG at 57,919,898 bp (GRCm38/mm10). This mutation deletes exon 3 and 54 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 9 bp deletion (GACTGGGAC) 43 bp before the 170 bp deletion and a 31 bp deletion (CAGTGGTGGAGTTCTCAGAGGGGAAAAGGAG) 22 bp after the 170 bp deletion, which will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 74 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tbc1d31 Mutation: 47 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)