About   Help   FAQ
Tnks1bp1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tnks1bp1em1(IMPC)J
Name: tankyrase 1 binding protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5795838
Synonyms: Tnks1bp1em1J
Gene: Tnks1bp1  Location: Chr2:84878366-84903392 bp, + strand  Genetic Position: Chr2, 49.45 cM
Alliance: Tnks1bp1em1(IMPC)J page
IMPC: Tnks1bp1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Tnks1bp1-7965J-M7446 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACTTGCACCTAGAACGAT, AGGTTGGAGTGTGGAAGATT, ATTCAGGCAAACCCAGGCTA and ATAGCCCCTTTAAGACTTCA, which resulted in a 837 bp deletion beginning at Chromosome 2 positive strand position 85,051,847 bp ATTCGGTGCAGCAGGAGTCA, and ending after TTCAGGCAAACCCAGGCTAA at 85,052,683 bp (GRCm38/mm10). This mutation deletes exon 3 and 206 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp deletion (GAACGATG) 24 bp before the 837 bp del and an 8 bp insertion (GCTTCCTT) at the site of the 837 bp del, which will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 32 and early truncation 7 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tnks1bp1 Mutation:  51 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory