Tnks1bp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnks1bp1^em1(IMPC)J
• Name: tankyrase 1 binding protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5795838
• Synonyms: Tnks1bp1^em1J
• Gene: Tnks1bp1 Location: Chr2:84878366-84903392 bp, + strand Genetic Position: Chr2, 49.45 cM
• Alliance: Tnks1bp1^em1(IMPC)J page
• IMPC: Tnks1bp1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Tnks1bp1-7965J-M7446 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACTTGCACCTAGAACGAT, AGGTTGGAGTGTGGAAGATT, ATTCAGGCAAACCCAGGCTA and ATAGCCCCTTTAAGACTTCA, which resulted in a 837 bp deletion beginning at Chromosome 2 positive strand position 85,051,847 bp ATTCGGTGCAGCAGGAGTCA, and ending after TTCAGGCAAACCCAGGCTAA at 85,052,683 bp (GRCm38/mm10). This mutation deletes exon 3 and 206 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp deletion (GAACGATG) 24 bp before the 837 bp del and an 8 bp insertion (GCTTCCTT) at the site of the 837 bp del, which will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 32 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tnks1bp1 Mutation: 51 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)