Adamtsl4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adamtsl4^em1(IMPC)J
• Name: ADAMTS-like 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5795948
• Synonyms: Adamtsl4^em1J
• Gene: Adamtsl4 Location: Chr3:95583511-95595228 bp, - strand Genetic Position: Chr3, 40.74 cM
• Alliance: Adamtsl4^em1(IMPC)J page
• IMPC: Adamtsl4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Adamts14-8000J-M9624 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGGCTTCACATTCCCACT, CTAGGTTATTAGACTAAGAG, AGGGACTGTGAACTGTTGGA and CGAGGGGTGGGGGACATCAG, which resulted in a 269 bp deletion beginning at Chromosome 3 negative strand position 95,685,133 bp GTTGGAAGGGGTCTGGCAAG, and ending after TGGCTTCACATTCCCACTGG at 95,684,865 bp (GRCm38/mm10). This mutation deletes exon 3 and 112 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 58 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Adamtsl4 Mutation: 76 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)