Slc44a2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc44a2^em1(IMPC)J
• Name: solute carrier family 44, member 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5796295
• Synonyms: Slc44a2^em1J
• Gene: Slc44a2 Location: Chr9:21232015-21266324 bp, + strand Genetic Position: Chr9, 7.77 cM
• Alliance: Slc44a2^em1(IMPC)J page
• IMPC: Slc44a2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Slc44a2-7954J-F6530 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGAAGAAGCTGGAGAGCCG, TGTGTCTGCATGCTACCAAC, TTTGCCGGAGAACACACACT and CACATCCCTCGTGGGGAAGA, which resulted in a 231 bp deletion beginning at Chromosome 9 positive strand position 21,338,315 bp TGTAGTCCCCTGTTGGTAGC, and ending after TGGGGAGATGTGTCCCAGTG at 21,338,545 bp (GRCm38/mm10). This mutation deletes exon 2 and 182 bp of flanking intronic sequence including the splice acceptor and donor. There is a single bp insertion (A) at the site of the deletion that will not alter the results of the mutation. This exon deletion is predicted to cause a change of amino acid sequence after residue 13 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc44a2 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)