AU040320^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: AU040320^em1(IMPC)J
• Name: expressed sequence AU040320; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5803696
• Synonyms: AU040320^em1J
• Gene: AU040320 Location: Chr4:126647331-126763487 bp, + strand Genetic Position: Chr4, 60.94 cM
• Alliance: AU040320^em1(IMPC)J page
• IMPC: AU040320 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project AU040320-7997J-M0236 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACTCACAGTAATCTCGTGC, TTCGATTCTGCCTCAGATGC, GACAACTGTTTTCGTTAGAG and TTGCTCATGCATAGATGCGG, which resulted in a 614 bp deletion beginning at Chromosome 4 positive strand position 126,791,731 bp, CTCGTGCTGGGTTCTTCCTA, and ending after TTAAATCTATTCCTCCGCAT at 126,792,344 bp (GRCm38/mm10). This mutation deletes exon 3 and 93 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 29 bp (TAGAGCGGAAGCTGCTCATTATCTGTTC) deletion 129 bp after the 614 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any AU040320 Mutation: 60 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)