Garre1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Garre1^em1(IMPC)J
• Name: granule associated Rac and RHOG effector 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5803794
• Synonyms: 4931406P16Rik^em1J
• Gene: Garre1 Location: Chr7:33936132-34012976 bp, - strand Genetic Position: Chr7, 19.48 cM
• Alliance: Garre1^em1(IMPC)J page
• IMPC: Garre1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project 4931406P16Rik-7996J-M9596 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACTTCTCAGGTAGCAGGG, AATAGAAGCCTAAACTCTGA, CGTATTAGTCACTCAGTAAC and GTTATCTCTGGGGGTCTCAC, which resulted in a 346 bp deletion beginning at Chromosome 7 negative strand position 34,254,222 bp, GGGGTCTCACTGGTCTCACTG, and ending after TGCACTTCTCAGGTAGCAG at 34,253,877 bp (GRCm38/mm10). This mutation deletes exon 8 and 248 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 418 and early truncation 63 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Garre1 Mutation: 49 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)