About   Help   FAQ
Fuca1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fuca1em1(IMPC)J
Name: fucosidase, alpha-L- 1, tissue; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5803874
Synonyms: Fuca1em1J
Gene: Fuca1  Location: Chr4:135648037-135667611 bp, + strand  Genetic Position: Chr4, 68.01 cM, cytoband D3
Alliance: Fuca1em1(IMPC)J page
IMPC: Fuca1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Fuca1-8333J-F7982 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACTAGATACAGATTCTGA, GTAATACCTGTCCGTAAGAC, TTCAGAACCTGTAATTCATA and TCAACTACCTTATGAATTAC, which resulted in a 186 bp deletion beginning at Chromosome 4 positive strand position 135,929,843 bp, AGACTGGACTAGATACAGAT, and ending after GTGGTTATCAACTACCTTAT at 135,930,028 bp (GRCm38/mm10). This mutation deletes exon 4 and 80 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 206 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Fuca1 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory