Ahsa1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ahsa1^em1(IMPC)J
• Name: AHA1, activator of heat shock protein ATPase 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5804023
• Synonyms: Ahsa1^em1J
• Gene: Ahsa1 Location: Chr12:87313253-87320772 bp, + strand Genetic Position: Chr12, 41.47 cM
• Alliance: Ahsa1^em1(IMPC)J page
• IMPC: Ahsa1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ahsa1-8007J-M4644 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACTTTTAGGAATCCAAA, GGTGACTGCAAGGTTAAAGG, GGATCAGAGCTATGGCAACG and AGCGGCATTGGGCACTCAGT, which resulted in a 428 bp deletion beginning at Chromosome 12 positive strand position 87,268,069 bp, CTCCTTTAACCTTGCAGTCA, and ending after TGGGCACTCAGTGGGACGC at 87,268,496 bp (GRCm38/mm10). This mutation deletes exon 2 and 237 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (CTTTGGATTC) 62 bp 5-prime of the 428 bp deletion that will not alter the results of the large deletion. This mutation is predicted to cause a change of amino acid sequence after residue 27 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ahsa1 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)