Tmem131l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem131l^em1(IMPC)J
• Name: transmembrane 131 like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5804137
• Synonyms: Tmem131l^em1J
• Gene: Tmem131l Location: Chr3:83804962-83947482 bp, - strand Genetic Position: Chr3, 37.42 cM
• Alliance: Tmem131l^em1(IMPC)J page
• IMPC: Tmem131l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project D930015E06Rik-8030J-M9888 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGAGCCTGAACACCTGGCAA, AGCGCTCCTGTGCCATTGGG, TTTGCCGTGCATTACAAACG and GCCACCCGAGGGGTGAGCCG, which resulted in a 247 bp deletion beginning at Chromosome 3 negative strand position 84,039,415 bp ACGCGGTGTGTTTTTTTGGT and ending after CGAGCCTGAACACCTGGCAA at 84,039,169 bp (GRCm38/mm10). This mutation deletes exon 2 and 176 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmem131l Mutation: 77 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)