Ccdc59^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc59^em1(IMPC)J
• Name: coiled-coil domain containing 59; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5804139
• Synonyms: Ccdc59^-, Ccdc59^em1J
• Gene: Ccdc59 Location: Chr10:105677340-105683371 bp, + strand Genetic Position: Chr10, 55.12 cM
• Alliance: Ccdc59^em1(IMPC)J page
• IMPC: Ccdc59 gene page

Ccdc59^em1(IMPC)J/Ccdc59^em1(IMPC)J mice exhibit embryonic lethality, with no embryos seen at E9.5 and only a small percentage of necrotic embryos at E7.5. Embryos fail to gastrulate, are smaller, with absent egg cylinders, head folds, primitive node, and primitive streak formation at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ccdc59-8014J-F4739 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCAGTGTACCATTAAA, TCGCTGTTACCCTTATATTT, AATGTTTTACTGACGACACA and TGAGGAATTTCTGAAGACGG, which resulted in a 495 bp deletion beginning at Chromosome 10 positive strand position 105,842,368 bp, CTTATATTTAGGTAAAGGGC, and ending after AGGAAGGTAAGCACCTCCGT at 105,842,862 bp (GRCm38/mm10). This mutation deletes exon 2 and 188 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ccdc59 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)